Table 1. Primers used for PCR amplification to obtain exons (ex-1, ex-2, ex-3, ex-4, ex-6, ex-7, and ex-8+ex-9) of the mRNA transcription variant-2 of the rat renalase gene (Rattus norvegicus).
|
Exon no. |
Primer code |
Primer structure(5' → 3') |
Primer size (nucleotides) |
|
ex-1 |
1RR-for |
atgggtcgcGGATCCatgttccgggtactggtggtg |
36 |
|
ex-1 |
1RR-rev |
ctatgtccccagccttgtcc |
20 |
|
ex-2 |
2RR-for |
ggacaaggctgggga cat agggggaagaatgactactgc |
40 |
|
ex-3 |
2RR-rev |
ttttggtgctttttggc |
23 |
|
ex-3 |
3RR-for |
gccaaaaagcaccaaaatttttagaggagcttttagctc |
40 |
|
ex-3 |
3RR-rev |
ctgattctttcaagtagtacttg |
23 |
|
ex-4 |
4RR-for |
caagtactacttgaaagaatcaggtgctgaagtcttcc |
38 |
|
ex-4 |
4RR-rev |
agttcacaatgtcaccttg |
22 |
|
ex-6 |
6RR-for |
caaggtgacattgtgaacttaattagtgaacgccagaggc |
40 |
|
ex-6 |
6RR-rev |
ctgtgttgcgcttcttactg |
20 |
|
ex-7 |
7RR-for |
cagtaagaagcgcaacacagagtcatcagaatgtggcccattgc |
44 |
|
ex-7 |
7RR-rev |
ctgtgaatatctccacttcc |
20 |
|
ex-8 |
8RR-for |
ggaagtggagatattcacaggttacaaactcagctgccaac |
43 |
|
ex-8 и ex-9 |
8-9RR-rev |
agctgtccaCTCGAGtcagatgtatatcaggaaagggttgag |
42 |
Note. The overlapping area of neighboring exons is shown in the structure of forward (RR-for) primers (nucleotides are in italics and bold). Primers 1Re-for and 8-9Re-rev include BamHI and XhoI restriction sites, respectively (nucleotides are shown by capital letters). Primer 8-9Re-rev contains a nucleotide sequence (15 nucleotides) of exon 8, nucleotide sequence of exon 9 (9 nucleotides), stop codon (tca - in bold and underlined) and the XhoI restriction site (CTCGAG)/